Predicting what you thinking ...

Mitchell [ machine learning guru, author of the most lucid book on the subject, http://www.cs.cmu.edu/%7Etom/mlbook.html ] et al. in the article titled "Predicting Human Brain Activity Associated with the Meanings of Nouns" [ http://www.sciencemag.org/cgi/content/abstract/320/5880/1191 ] have developed a computational model based on fMRI scans predicting what you thinking ... more at http://www.nature.com/news/2008/080529/full/news.2008.864.html .

clipped from www.nature.com A computer model has been developed that can predict what word you are thinking of. The model may help to resolve questions about how the brain processes words and language, and might even lead to techniques for decoding people’s thoughts. The team then used functional magnetic resonance imaging (fMRI) to scan the brains of 9 volunteers as they looked at images of the nouns. The researchers then fed the model 58 of the 60 nouns to train it. For each noun, the model sorted through a trillion-word body of text to find how it was related to the 25 verbs, and how that related to the activation pattern.

Music from DNA string

Had this thought of converting DNA strings to MIDI music files using Sean [ http://groups.google.com/groups/profile?enc_user=N0KQ5w8AAAD0VD270uUpCbIPP1utz--x ] 's MIDI module for PERL way back [ http://groups.google.com/group/DNA-Music/about ] in JNU days when I was working on improving fourier transform based coding region prediction [ http://www.ncbi.nlm.nih.gov/pubmed/11927773 ] .
Recently I got this opportunity to participate in YSR [ http://www.sars.no/seminars/Retreat_2008_invitation.pdf ] where I finally hacked together these ideas of converting the DNA strings to MIDI music. I am just coming back from there. The evening was full of serious biology talks from mostly experimental biologist [ http://www.uib.no/People/ash022/BYSR08_program_HR_GB.pdf ] where I hope, I lived up to the reputations of being a Bioinformatician, for not just having fun with computers but justifying out salary by plugging in the biological data somehow
The presentation tries to explain the flowchart in 4 slides [slideshare: http://www.slideshare.net/sharma_animesh/ysr-presentation-animesh-rev/ , pdf: http://sharma.animesh.googlepages.com/YSR_Presentation_Animesh_Rev.pdf ].
The code [ http://sharma.animesh.googlepages.com/create_music_from_string.pl ] depends on Sean's MIDI module for PERL which can be downloaded from CPAN [ http://search.cpan.org/~sburke/MIDI-Perl-0.81/lib/MIDI/Simple.pm ] takes in sequence in fasta format [ eg: http://sharma.animesh.googlepages.com/telo.fas , it does accept multiple sequences ] and outputs a MIDI file [ eg: http://sharma.animesh.googlepages.com/telo.fas.0.midi ] and DFT values [ eg: http://sharma.animesh.googlepages.com/telo.fas.0.fft , NOTE: for multiple sequences, the counter starts from 0 for 1st sequence and goes to N-1 for Nth sequence].
To play the midi files [ eg: http://sharma.animesh.googlepages.com/FLJ20436.fas.0.midi generated from http://sharma.animesh.googlepages.com/FLJ20436.fas ] in Linux, I would recommend to install timidity [ http://timidity.sourceforge.net/ ].
Lots need to be done to make this thing do something practical, like I need to change the code to to Fast Fourier transform, employ a window based strategy to walk through the whole genome and create region based music ...
By the way, there is a good use to look at the other generated file *.ff [ eg: http://sharma.animesh.googlepages.com/telo.fas.0.fft ] as well, it says a lot about the repeat length hidden in the sequence.
Like the sequence ( http://sharma.animesh.googlepages.com/telo.fas ) I used initially is:
>teloseq
AGGGTTAGGGTTAGGGTTAGG
which has telomere repeat signal TTAGGG of length 6, now when we look at its fft file ( http://sharma.animesh.googlepages.com/telo.fas.0.fft ) and plot it ( http://sharma.animesh.googlepages.com/telo.jpg ), we observe a peak (defined in the original paper as more then signal of 4) around 6 and 3.
Coding regions generally show a peak at 3, hypothesis being the codon usage bias in the coding strand, while non-coding regions lack this property (not useful in eucaryotic sequences as they have introns too)... so in a way if you input a sequence from coding region to this code, you might find a peak at 3 in the *.fft generated.
To read more about MIDI encoding, I would suggest "The Musician's Guide to MIDI by Christian Braut" [ http://www.amazon.com/Musicians-Guide-Sybex-Macintosh-library/dp/0782112854 ].
Now I need to train my ears to listen to lots of coding and non-coding region music and then given some unknown sequence, predict if it belongs to either of these regions just by listening to its midi file

clipped from www.sars.no Young Scientist's Retreat - Bergen 2008, Invitation Open to all phd students and postdocs at MBI, Dept. of Informatics, Dept of Biomedicine, Sars Centre and CBU. To register contact Ståle Ellingsen. May 22 Sydneshaugen Skole 12:00-18:00 Host: MCB Research School

Faster way to screen nonribosomal peptides

Bandeira et al. in the paper "De Novo Sequencing of Nonribosomal Peptides" ( http://www.springerlink.com/content/n532545722750915/ ) outline a strategy based on MS alignment leading to faster nonribosomal peptides (example penicillin) screening. This has potential to hasten the process of finding new drugs (better say candidates?).

clipped from www.genengnews.com If you imagine the structure of an NRP as a cyclic string of beads, then the new algorithms both decipher the mass of each bead based on the mass spectrometry and determine the order of the beads within the ring crucial pieces of information for uncovering both the structure of the molecule and its pharmacological activities.

Rosendal Meet

I was attending the Rosendal meet (from 6-8 th May, 2008) between members of CBU (Computational Biology Unit ... and Department of Informatics, University of Bergen, Norway) and MB-NIMR (Division of Mathematical Biology at National Institute for Medical Research, MRC, London group, UK).

Thanks to Xianjun for posting the pictures from the trip at http://picasaweb.google.com/sterding/Rosendal2008 (the beautiful pic above is coming from there) and Anders at http://flickr.com/photos/lanzen/sets/72157605097913531/ . The ones from my camera are available at http://picasaweb.google.com/sharma.animesh/Rosendal_meet?authkey=wFgJVxkGwTU .

Workshop: BREW 2008

I was in Bielefeld, Germany for BREW2008 workshop. I was quite suspicious of this place as people (http://www.cebitec.uni-bielefeld.de/index.php?option=com_cudbhome&task=show&cudbname=sniemeie , http://www.cebitec.uni-bielefeld.de/index.php?option=com_cudbhome&task=show&cudbname=twittkop ) informed me that Bielefeld does not exist ( http://en.wikipedia.org/wiki/Bielefeld_Conspiracy )! So I went out and took loads of snaps ( http://picasaweb.google.com/sharma.animesh/BREW2008?authkey=ranwczoE2-Q ) to prove its existence ... well on second thought map is not the territory ( http://en.wikipedia.org/wiki/Thomas_Kuhn ).
Coming back to the workshop, this is a nice event with a great concept ( http://bib.oxfordjournals.org/cgi/content/abstract/9/3/250 ) organised by and for people from:
* International Graduate School in Bioinformatics and Genome Research, University of Bielefeld, Germany ( http://www.cebitec.uni-bielefeld.de/gradschool/ )
* Molecular and Computational Biology Research School, University of Bergen, Norway ( http://www.mcb.uib.no/ )
* Max Planck Research School for Computational Biology and Scientific Computing (IMPRS-CBSC), Berlin, Germany ( http://www.imprs-cbsc.mpg.de/ )
* EBI PhD Program, European Bioinformatics Institute, England ( http://www.ebi.ac.uk/ )
* ComBi Program, University of Helsinki, Finland ( http://www.cs.helsinki.fi/ )
I had a great time there and would recommend people from the above list to go for BREW 2009 which is tentatively scheduled after a year at http://www.cs.helsinki.fi/ ... (?)

clipped from www.techfak.uni-bielefeld.de BREW 2008 Bioinformatics Research and Education Workshop, Bielefeld, Germany April 28-30 2008 March 1th -- Abstract submission deadline March 7th -- Paper submission deadline March 20th -- Review deadline April 11th -- Deadline for final version of paper April 28th -- Meeting in Bielefeld About BREW BREW aims to give an introduction to scientific conferences, including submission, peer review and presentation of scientific papers. All participants must submit a paper and take part in reviewing papers from other participants in order to attend the workshop. After the review deadline, you have a chance to make alterations to your paper and deliver a final version. All participants will present their paper at the meeting in April. BREW is held in an around-robin fashion each year at the participating PhD programs: Bergen (2007), Cambridge (2006), Berlin (2005), Helsinki (2004), Bielefeld (2003), and Hinxton (2002).